Primer Design

From bio-physics-wiki

Jump to: navigation, search

In order to amplify a specific DNA template via Polymerase Chain Reaction, one first has to design primers, short sequences of single stranded DNA, that initiate the Polymerase binding and synthesis of the complementary strand. By raising the temperature above $95°C$ the DNA melts (or denatures) and separates into two single strands. Thus we need to design two primers, a forward and a reverse primer.

PrimerDesing.png
  1. Choose a Plasmid, suitable for your organism (e.g. from NewEnglandBiolabs). For this demonstration we use the following
    PlasmidPrimerDesing.png
  2. Find the sequence of the gene you want to amplify. Just search the gene in a database (e.g. ecocyc, yeastcyc, KEGG)
  3. For the choosen plasmid shown above, the restriction of the cloning site can be done with all Restriction Enzymes shown bold font. Choose one of the Restriction Enzymes, that does not cut the DNA that you want to amplify. You can check, if your DNA template has a restriction site for the enzyme you want to use, by copying the sequence into e.g. webcutter [1] or NEBcutter [2] (you can specify the cloning site restriction enzymes, this will confine the answer of possible restiction sites). The tools will tell you all restriction enzymes, that cut your template. Choose enzymes listed in bold (see picture above), that do not cut the DNA template. Choose one enzyme for the forward and one for the reverse direction.
  4. Find the exact sequence of the restriction sites for the choosen enzymes. If possible take $NdeI$ $ C{}^{\downarrow}ATAT{}_{\uparrow}G$ as forward primer, because the start codon is usually ATG, which is the same as the last three letters of the restriction site (In any case, make sure the enzyme cuts before the start codon!). In this example we have choosen the gene GLK1 from yeast and we can use $NdeI$. Common stop codons are $TAA$, $TAG$ and $TGA$, for GLK1 the stop codon is $TGA$. You can use the ApE Software ([3]) to create the reverse complement of the nucleotide sequence, which is the reverse (read from end to start) sequence of the complementary (bottom) sequence. Download the free software enter the sequence, click Edit-Reverse Complement. Search again an enzyme that cuts before the reverse complemented stop codon (TCA). If you check the restriction enzymes listed in bold you find, that $EcoRI$ has the restriction site $G{}^{\downarrow}AATT{}_{\uparrow}C$, that ends with a TC and thus overlaps with the reverse complemented stop codon.
  5. We are now ready for the last step. The first letters of your primer shoud be CCCGGG, they increase the affinity for the polymerase. They are followed by the letters of the respective restriction enzymes and finally by a specific number of letters from your template DNA. How many letters is determined by the melting temperature $T_m$, it should be above $60°C$. The melting temperature characterises the binding specificity of your primer to the template. If the melting temperature is to low not only the primer, but also the denatured double strands might reanneal. Moreover, G-C pairs have three hydrogen bonds, while A-T pairs only have two, thus GC pairs cause stronger bonds. G-C rich regions therefore also increase the binding specificity. Make sure the G-C content of your primer is above 50%. Both parameters the melting temperature and the G-C percentage of a sequence are given by ApE Software ([4]) if letters are selected with the cursor. For our example the primers are

$\hspace{5cm}$Forward Primer:$\hspace{0.5cm}$CCCGGGCATATGTCATTCGACGACTTACACAAAGC

$\hspace{5cm}$Reverse Primer:$\hspace{0.5cm}$CCCGGGGAATTCTCATGCTACAAGC

they can be orderd online on e.g. New England Biolabs



Many thanks to Alvin Teo for the stimulating discussion, tips and tricks.